Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XG765
Clone ID XG765
Vector pGT1Lxf
Project baygenomics

Sequence tag XG765
Sequence
GGCATCAGTGTAACTTACAATGTGGGTGACTTCAGGTGCCGGACAACCTTTTACTACAGCCCTCACTCGCCTTCTGATGG
TAGACCT
Sequence Type mRNA
Unitrap ID UNI9281

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 33218241..33218326 79
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040594 (Ranbp17) NM_023146 RAN binding protein 17 Gene [Source:MGI (curated);Acc:Ranbp17-001]

 
Come back to gene ENSMUSG00000040594


For any suggestions or comments, please send an email to unitrap@crg.es