Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST31531
Clone ID OST31531
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST31531
Sequence
GTGTTTTTCGACAACGTATTCTGAAGATTTCACTCCCAGTATGAATATCCACCACCTGCCTGTCCTCGCCGAGAAGAGTA
CTCCATAGTCCACAGGAAGTGCCGTTCTCAATTCACAGACCTCAATGGCTCCAAAAGACTTGGCATCAACACATGGCACG
ATGAGAGTGGAATTTATGCTAATTCAGAGGCAAAACAAAAACTCTACGCATTGGCTAGAAATCCTATTGTCCCATTTTAA
AAAGCAATGTATACAACCAGACCCTCATGCTAATGAAAAACGACAAATGTAGTAGTTAATAATTTTCATAATAAAAACAA
AGCCTTCCAAATCTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI28415

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 23633243..23647032 277
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033053 (1700028P14Rik) NM_026188 RIKEN cDNA 1700028P14 gene Gene [Source:MGI Symbol;Acc:MGI:1914733]

 
Come back to gene ENSMUSG00000033053


For any suggestions or comments, please send an email to unitrap@crg.es