Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST31516
Clone ID OST31516
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST31516
Sequence
TCCGAGATGCTGAGCGTGTAAAGGAAATGAAACGAATGCATAAAGCTGTTCAGAAGGATCTGCCCAGGCCGTCTGAAGTA
AATGAAACTATTTTAAGACCTTTAAATGTAGAACCACCTCTAACAGATTTACAGAAGAGTGAAGAACTGATCAAAAAAGA
AATGATTACGATGCTTCATTATGATCTTCTACATCATCCCTACGAACCATCTGGAAATAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI28417

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45544841..45545361 147
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023932 (Cdc5l) NM_152810 cell division cycle 5-like (S. pombe) Gene [Source:MGI Symbol;Acc:MGI:1918952]

 
Come back to gene ENSMUSG00000023932


For any suggestions or comments, please send an email to unitrap@crg.es