Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST31306
Clone ID OST31306
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST31306
Sequence
GACTTGTGCAGAGAGCTCCATGCCAAGGTGGAGGTGGTGGATGAGGAGCGCTATGATATTGAAGCCAAATGCCTCCACAA
CACCAGAGAGATCAAGGACCTGAAGCTGAAGGTGCTGGACCTCCGTGGGAAGTTCAAGCGTCCTCCCCTGCGCCGGGTCC
GTGTCTCAGCCGATGCCATGCTCCGAGCCCTACTGGGCTCTAAGCACAAGGTGTCCATGGATCTGCGGGCCAACCTCAAG
TCTGTGAAGAAAGAAGACACAGAAAAGGAGCGGCCAGTCGAGGTAGGAGACTGGAGGAAGAATGTGGAGGCTATGTCTGG
CATGGAAGGCCGCAAGAAGATGTTCGACGCTGCTAAGTCCCCGACCTCCCAGTAGAGGTNNNTNTNNTGTANNNNGGNNT
NCGTAANGCNTNGCACNNTTNTCAGGNNAACNGANCTANCTTTCTGCTCGTGCCTGGAACATCC
Sequence Type mRNA
Unitrap ID UNI28426

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 137705208..137707276 181
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026418 (Tnni1) NP_001106173 troponin I, skeletal, slow 1 Gene [Source:MGI Symbol;Acc:MGI:105073]

 
Come back to gene ENSMUSG00000026418


For any suggestions or comments, please send an email to unitrap@crg.es