Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XH057
Clone ID XH057
Vector pGT1Lxf
Project baygenomics

Sequence tag XH057
Sequence
GATGACTTGGATGGCTTTGCAGAGGGCGGCATGATTGATCAGGAGACTGTAAATGCTGAATGGGAAACTGTGAAAGCCTC
AGAACCTGTTAAAGAGCCAGTGCAGACTGCACAGAGTCCAGCTCCAGTTGAGAAGGAGTCAGTGGTCACCACACAGGCAG
AGGTTTTCCCTCCTCCTGTCGCCATGCTGCAGATTCCTGTAGCACCAGCTGTTCCTGCAGTTAGCTTAGTTCCTCCAGCG
TTTCCTGTGTCGATGCCTGTCCCCCATCCTGGATTCAACCCGATCCCTCCACCTCCTTTTCTACGAGCAAGTTTTAACCC
TTCACAACCACCTCCTGGTTTTATGCCACCTCCAGTTCCCCCACCTGTGGTACCTCCCCCTGCAATCCCACCGGTAGTAC
CAACAT
Sequence Type mRNA
Unitrap ID UNI9293

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 3187688..3193082 147
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046201 (Rbm16) RNA binding motif protein 16 Gene [Source:MGI Symbol;Acc:MGI:1925212]

 
Come back to gene ENSMUSG00000046201


For any suggestions or comments, please send an email to unitrap@crg.es