Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST31213
Clone ID OST31213
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST31213
Sequence
GCAGCGGAATATGTCCCAGAGAAGGTGAAGAAAGCGGAAAAGAAATTAGAAGAAAATCCATATGACCTTGATGCTTGGAG
CATTCTCATTCGAGAGGCACAGAATCAACCTATTGACANNGCACGGANNACTTNCTANCGCCTTGNTGCCNANTTNCCCA
NGTCTGGCNNATTCTGNANNCTGNACATTGAAGCNGNNGTTAATATGGTTATTTATTTTTTNTTATATCCATCTNATGGC
ACTTCAGCTTACCTATNCCGACAGACCAGAAGTNANGAACATNGTATAATCNGGACCTGGACGATTTAAATGTCTCTGCC
TTTATTTTGTAAAATAGGTATGANAGNAGTAATTAGGATGACTTTGAAACTCGGGTCTTTCACAAGCTGATGATTGGAGC
ATTTTGNAGTNGCGACCAACGTTGAAACAGTTGCAATGGGNTTNAATTGGNAAAATAGGTTGAAAGGAGT
Sequence Type mRNA
Unitrap ID UNI530

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 104449028..104449584 212
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027176 (Cstf3) NM_145529 cleavage stimulation factor, 3' pre-RNA, subunit 3 Gene [Source:MGI (curated);Acc:Cstf3-001]

 
Come back to gene ENSMUSG00000027176


For any suggestions or comments, please send an email to unitrap@crg.es