Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST31199
Clone ID OST31199
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST31199
Sequence
GGACTGGTGGAATCTGACAGATGCACANANGTGCNCCTTTCTATNGGACCAAAGAGGATTGAGGNGGGANTCGGCGNCCC
TCCCTGTTGCTTCATNNNNGTNGACACACNGATATNANNCCGACNCTNGAGCACANGANGCGGAAAGGGCTTNAAGCATA
GCTTCAACTTGGCTAACCACCTGCGCTCACACACTGGTGAACGACCCTACCGATGCTCTGCCTGCCCTAAGGGATTCCGA
GACTCCACTGGCCTGNTGCACCACCAGGGTGAAAAAAAAT
Sequence Type mRNA
Unitrap ID UNI513

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4964279..5039463 124
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061374 (Fiz1) NP_001103799 Flt3 interacting zinc finger protein 1 Gene [Source:MGI Symbol;Acc:MGI:1344336]

 
Come back to gene ENSMUSG00000061374


For any suggestions or comments, please send an email to unitrap@crg.es