Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST30734
Clone ID OST30734
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST30734
Sequence
GAAGCATGGATGGTTCCATATAGNACAAGAACATNTTTGGCACNCCCGAGTTTGTCGCCCCCGAGATCGTGAACTATGAG
CCACTTGGCTTGGAGGCTGACATGTGGAAGA
Sequence Type mRNA
Unitrap ID UNI28448

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 80653202..80653392 51
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034974 (Dapk3) NM_007828 death-associated protein kinase 3 Gene [Source:MGI Symbol;Acc:MGI:1203520]

 
Come back to gene ENSMUSG00000034974


For any suggestions or comments, please send an email to unitrap@crg.es