Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST30712
Clone ID OST30712
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST30712
Sequence
AGCTGCCAGATGCTGTTAAATCAGCTGCGAGAAATCACAGGCATCCAGGATCCTTCCTTTCTTCATGAAGCATTAAAGGT
TGGTTTCCAGACCCAGCTTAGCTGCCAGACGCTGAAGCAGTTTCCCACATGTCAGGTGTGTCAGCAGACGCTCTTTCTAT
ACCAGGTGCAAGCATAAGAACAGGAACCAACTACAGGTCAGGTGGTTAGTTTCTTCAACATAGAAACTTGGAAGTAGATG
GTGGGAATGTACAGNGGGCTTTTAGGAGTCNCAGCATCCATGTGCATTGTATCCATATGGATCCTGAGTGGGACCA
Sequence Type mRNA
Unitrap ID UNI16290

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 48808456..48808771 312
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032267 (Usp28) NM_175482 ubiquitin specific peptidase 28 Gene [Source:MGI Symbol;Acc:MGI:2442293]

 
Come back to gene ENSMUSG00000032267


For any suggestions or comments, please send an email to unitrap@crg.es