Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST30690
Clone ID OST30690
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST30690
Sequence
GACGTCTGGGGAGCTCCCGNCAGTCAGTGGTGGCCGTGATGCGGTACAGGGCATTTCTNCTTCCACCATCCACAGATGTT
CTCAATAAACTGTACATTCATTTTGAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI28450

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 116667434..116667529 90
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031024 (St5) NM_001001326 suppression of tumorigenicity 5 Gene [Source:MGI Symbol;Acc:MGI:108517]

 
Come back to gene ENSMUSG00000031024


For any suggestions or comments, please send an email to unitrap@crg.es