Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XH290
Clone ID XH290
Vector pGT1Lxf
Project baygenomics

Sequence tag XH290
Sequence
CTCACAAAGAAGGAGTTTTTTGGGTTTTTTTTTTTTTTTGTTTTTTCCCCCTTAAAAAAGGTTTTTTTTGGATTGTCATT
TGGGCTCCCTGCTGAAAGCCATTTTGTTTTTCAGGACGCTTTGCAAGGGTAGCTGGGGTGAATTTGCACCAAGGCAGCAG
CATAGTCGCCGCAGTTCCATCTTCGTCTCCGCGATGTTGCCCTTAGCCAAAAACGCACTAAGCCGTCTCCA
Sequence Type mRNA
Unitrap ID UNI6403

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 103211048..103211207 158
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031231 (Cox7b) NM_025379 cytochrome c oxidase subunit VIIb Gene [Source:MGI (curated);Acc:Cox7b-001]

 
Come back to gene ENSMUSG00000031231


For any suggestions or comments, please send an email to unitrap@crg.es