Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XH291
Clone ID XH291
Vector pGT1Lxf
Project baygenomics

Sequence tag XH291
Sequence
TGCGGCTGGCGCGGGAGCCTGGCGGAGGGTCGCGATGCCGTACGCCAACCAGCCAACAGTGCGGATCACGGAACTCACCG
AAGAGAACGTCAAGTTCATTATCGAGAACACGGACCTGGCGGTGGCCAATTCCATTCGGAGGGTCTTCATCGCAGAGGTG
CCCATAATAGCCATCGACTGGGTTCAGATTGACGCCAACTCCTCGGTCCTTCATGATGAATTCATCGCGCACAGGCTTGG
TTTAATCCCCCTCACTAGTGATGACATTGTGGACAAGCT
Sequence Type mRNA
Unitrap ID UNI9310

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 97381422..97384383 121
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031783 (Polr2c) NM_009090 polymerase (RNA) II (DNA directed) polypeptide C Gene [Source:MGI Symbol;Acc:MGI:109299]

 
Come back to gene ENSMUSG00000031783


For any suggestions or comments, please send an email to unitrap@crg.es