Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST30575
Clone ID OST30575
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST30575
Sequence
ATTTTGTATTTTGTACATACATTTTGTATATTCTGTATATGATGACTTCTGTGAGCAATGATCGTTGCCGAGGTGCTCGG
GAAAAACCACAGATGCCAACAGCACACGCAGCCCAGTCACAGAAACAAGTGGTGCAGGCAACAGCTGAGCAGATGCGGCT
TGCTCAAGTGATCTTTGATAAGAATGATTCAGATTTTGAAGCTAAAGTTAAGCAGCTTATGGAAGTGACGGGAAAAAATC
AGGATGAATGCATCGTGGCCCTACATGACTGTAATGGTGATGTGAACAAAGCTATCAATATACTGNTGGAAGGGAATTCT
GGCACCCCTTTNNTGGAGACTGTAGGAGGGAAGAAGAAGAATTTTGGAAGAGAAAGTTCAGAAAACAAAG
Sequence Type mRNA
Unitrap ID UNI18460

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 41176818..41198704 139
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028433 (Ubap2) NM_026872 ubiquitin-associated protein 2 Gene [Source:MGI (curated);Acc:Ubap2-001]

 
Come back to gene ENSMUSG00000028433


For any suggestions or comments, please send an email to unitrap@crg.es