Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST30572
Clone ID OST30572
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST30572
Sequence
TCTGGGGAGCTCCTGCATTAAGNTACAACTGAGAGTGACCAGGCTCCTCATCAGAGGTGGACGCATCATCAATGATGACC
AGTCCTTCTACGCCGATGTCTACCTAGAAGATGGACTCATAAAACAAATAGGAGAGAACCTGATTGTTCCTGGTGGAGTG
AAGACCATCGAGGCGAATGGCCGAATGGTCATTCCCGGTGGCATTGATGTCAACACTTACCTGNCTNAGCNNTNNNAGGG
CNTGACCTGGGNTGATGACTTTNTCCANGGCACTAAANCAGNGCTGGCAGNTGGANCCTCNATGATCATTGACCANGTNN
TNNCNGAACCNGGGTACAACTTGNTGGCTTCNTTNGAGAANTGGCACGAACATTNCTGACCNCGNCCTGTCTGANGATTA
TCTTACAGTGGCCTGACATAC
Sequence Type mRNA
Unitrap ID UNI7395

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 37656469..37660110 145
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029121 (Crmp1) NM_007765 collapsin response mediator protein 1 Gene [Source:MGI Symbol;Acc:MGI:107793]

 
Come back to gene ENSMUSG00000029121


For any suggestions or comments, please send an email to unitrap@crg.es