Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC0543
Clone ID GC0543
Cell line E14Tg2A.4
Vector pFLIP1
Project tigem
Note NULL

Sequence tag GC0543
Sequence
TTGCCTTTGGTTGGTTTCTCGTTTGGAGTATCAGTTGAAACAGTTAATTCAATATTATCTGGATCGCCTCCTTCCTCTTC
AATAGCCTGCTTCAGCCGGGAGACCAGTACCGTCTTGACCCCGTTGATGTCCAAGTTGCGGCGCTTCAGCTCGGACCTGA
GGTCGACAACCGCAGCTCGGTGATCTTCTTCCCTTCCGCCGGCCCAGAGGCGGCCGAGGCTACCACGGCCCCGGCAGCGG
CAG
Sequence Type mRNA
Unitrap ID UNI114

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 70390731..70391862 151
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032212 (Sltm) NM_025690 SAFB-like, transcription modulator Gene [Source:MGI Symbol;Acc:MGI:1913910]

 
Come back to gene ENSMUSG00000032212


For any suggestions or comments, please send an email to unitrap@crg.es