Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST30446
Clone ID OST30446
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST30446
Sequence
GATCTGACTTCGACGCTTAATTTTGAAGATGCTGGAGTCGTACGTAACTCCAATTTTAATGAGTTATGTGAATCGCTATA
TCAAGAACTTAAAGCCTTCAGATCTCCAGCTTTCACTATGGGGTGGGGACGTGGTTCTCAGCAAACTCGAGTTAAAGTTG
GACGTTCTGGAACAGGAACTGAAATTACCATTCACTTTTTTAAGTGGCCATATCCACGAACTGAGAATTCATGTACCATG
GACAAAATTGGGCTCCGAACCTGTGGTAATTACCATCAACACAATGGAATGCATCTTGAAACTTAAAGATGGAATACAGG
ATGACCATGAAAGCTGTGGTTCTAATTCTACCAACCGTAGCACTGCTGAGAACACAAAATCATTCATAAAACCCCGAAGA
ATTCAACANGCTGNTTCTGGCAAACCTTGCTTACC
Sequence Type mRNA
Unitrap ID UNI28458

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 35301688..35347381 172
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037646 (Vps13b) vacuolar protein sorting 13B (yeast) Gene [Source:MGI Symbol;Acc:MGI:1916380]

 
Come back to gene ENSMUSG00000037646


For any suggestions or comments, please send an email to unitrap@crg.es