Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST30317
Clone ID OST30317
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST30317
Sequence
GCTTCTCTTACGTACGCGGAAGCACAGATGAGAATTGATTCGGCGGCTATGAATGATGATATTACCACTAGTCTCCGTGG
ACTCAATCAGCTGGCTAAAATTCTAAAAAAGGGAAGGATTGAAAAGGGGGCTTTGACTCTGTCTTCTCCAGAGATCCGAT
TCCACATGGACAGTGAAACCCACGACCCAATCGACCTGCAGACGAAAGAGCTGAGAGAAACAAATTCCATGGTGGAAGAA
TTTATGTTACTTGCTAATATTTCTGTCGCAAAAAAAATTCATGAAGAGTTTTCTGAACATGCTCTGCTTCGGAAACACCC
AGCTCCGCCTCCCTCGAATTATGACATTCTTGTTAAGGCTGCAAAGTCCAAGAATTTGCAAATTAAGACTGATACAGCCA
AATCTTTGGCCGACTCTTTGGACCGGCTGAATC
Sequence Type mRNA
Unitrap ID UNI28465

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 99479037..99483373 159
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033166 (Dis3) NP_082591 DIS3 mitotic control homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1919912]

 
Come back to gene ENSMUSG00000033166


For any suggestions or comments, please send an email to unitrap@crg.es