Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST30314
Clone ID OST30314
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST30314
Sequence
GAAGCGTCCTGATCAGACATGGGTTCAATGTGACGCTTGTCTAAAGTGGCGAAAGTTACCAGATGGGATAGATCAGCTTC
CAGAAAAATGAAACTGTGAAGTTCCGGAAGAACCTGAAGATGAGGATTTAGTGCATCCTACTTATGAGAAAACCTATAAA
AAGACGAGCAAGGAGAGATTCAGGATCAGACAACCGGAAATCCTCCCTCGAATCCTCCCTCAGATTAACCCTGAGCTATT
GTATCAGACAAGTGTTTCAAGTCAGAGCTTCTCCCCTGTGAAGGAGAGCGTTCCAAGACCACATCTTTCTGAAGTCACGA
GTCCCTTTGCAGCAAGGATTATAAATCTCAACCTTGCTTCACCAGCGTCTGAACCTGAGAACAGTAGCATGAAGCGGAAA
CTTGGTGTTCACTCATCAATTCTGAATGCAAAGA
Sequence Type mRNA
Unitrap ID UNI28466

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 93862659..93870655 171
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039456 (Morc3) NP_001038994 microrchidia 3 Gene [Source:MGI Symbol;Acc:MGI:2136841]

 
Come back to gene ENSMUSG00000039456


For any suggestions or comments, please send an email to unitrap@crg.es