Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST30205
Clone ID OST30205
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST30205
Sequence
ATATTCAGGAGACTTATGAATCATTGTANGACCACATTAGNNTCTTGTCTCGACAGAATCATTAATGANNGCAGCATCTC
GTACCGAAATACTANATCGCGAAGACTGATTCAGTGGCCCAAGGCTCTTCAAGGAATACAATAATTAAGAACAGGAGCCT
CCTGAGAAGGCGTTGAGTAGACAGACTGTTGAGAGGCCACAGAGTGCACTTGGAAAAACTCATTTCTGTGCTGCAAAGCA
ATGGTGGGGAGGCGCAGTGCCCGACTGCTGTA
Sequence Type mRNA
Unitrap ID UNI28472

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 51618149..51618309 146
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022312 (Eif3h) NM_080635 eukaryotic translation initiation factor 3, subunit H Gene [Source:MGI Symbol;Acc:MGI:1915385]

 
Come back to gene ENSMUSG00000022312


For any suggestions or comments, please send an email to unitrap@crg.es