Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST30188
Clone ID OST30188
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST30188
Sequence
GGTTATGTCCTGTGTTGTGACCTCATGGTTTAAGTGGGAATAAAGATGAGTAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI7052

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 22078125..22078179 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027630 (AC121108.12) NM_030732 F-box-like/WD repeat-containing protein TBL1XR1 (Transducin beta-like 1X-related protein 1)(Nuclear receptor corepressor/HDAC3 complex subunit TBLR1)(TBL1-related protein 1) [Source:UniProtKB/Swiss-Prot;Acc:Q8BHJ5]

 
Come back to gene ENSMUSG00000027630


For any suggestions or comments, please send an email to unitrap@crg.es