Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST30163
Clone ID OST30163
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST30163
Sequence
TGTAAACCAGAATACAAGGTACCTGGACTATATGTTATTGACTCCATTGTGCGACAATCCCGGCATCAGTTTGGTCAAGA
AAAGGATGTGTTTGCACCCAGATTTAGTAATAACATCATTAGCACTTTTCAGAATTTATATCGTTGCCCTGGGGATGACA
AGG
Sequence Type mRNA
Unitrap ID UNI14525

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 3159163..3159325 163
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046201 (Rbm16) RNA binding motif protein 16 Gene [Source:MGI Symbol;Acc:MGI:1925212]

 
Come back to gene ENSMUSG00000046201


For any suggestions or comments, please send an email to unitrap@crg.es