Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST30091
Clone ID OST30091
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST30091
Sequence
TGAAGCCAATAAGCAACATGTAAGATGTCAGAAATGCTTGGAATTTGGACATTGGACTTATGAATGCAAAGGGAAAAGAA
AGTACCTACACAGACCTTCGAGAACGGCAGAGCTGAAGAAAGCTTTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI11583

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 53140771..53140906 134
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018239 (Zcchc10) NM_026479 zinc finger, CCHC domain containing 10 Gene [Source:MGI (curated);Acc:Zcchc10-001]

 
Come back to gene ENSMUSG00000018239


For any suggestions or comments, please send an email to unitrap@crg.es