Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AZ0088
Clone ID AZ0088
Vector pGT0lxr
Project sanger

Sequence tag AZ0088
Sequence
GCAAGCGTGAGAGAANGGAAGGAACATNTGCTGTGCAGTCAGGCAGCAGCAGCCCGAAGAGCCAGCACCCACCACCACTA
ACCGAGAGGTCTGACCTTGGTGGGTCAGAAGCCTCAGTCTTCGGATATGGATTAGCAGCCAATGCGCCCACATACGCAGT
TGACGCGAGAGGAATCAGTTGGAAACCTGGTGGTCGCGGGTATTCCATAACTAAGGACCGAGTGGGGCAGGTTTGGAGCA
GTTCCCTGGCTGTGGGGACATATCGGCTAGAGCGCAATGTTGAGAGTAGAAGCGAGGGGCAATAGGGCGATGGAAGGGGG
ATTGCGAGTAGATGGCAGGAAGGCACCCCCAAAGGACAGCAAATATGTGGAAGAACTGGAAGCCCTTTTCCCAGATCTGC
CCAAAAGAAAGGACATATTTGATTCCCTGCAGAAGGCCAAGTTTGACGTCTCAGGACTGACCACTGAACAGATGCTCAGA
AAGGACCAGAAGACAGTCTACAGACAGGGCACCAAGGTGGCAATCAGTGCAATCTACATGGACTTGAAG
Sequence Type mRNA
Unitrap ID UNI1008

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95063162..95949572 117
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015711 (Prune) NM_173347 prune homolog (Drosophila) Gene [Source:MGI (curated);Acc:Prune-001]

 
Come back to gene ENSMUSG00000015711


For any suggestions or comments, please send an email to unitrap@crg.es