Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST30033
Clone ID OST30033
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST30033
Sequence
GTTTTGAGAGATTGCTACAATTTGGACTCACAAGCAAGATTTACTGCAAACTTTGAGATGGAGTAGGTACTTTTCAGATG
GTGGCTGGCTGCCCAGAAAGATGCTGTAGTGAAACTAGGAGAAGNTGATTTCCAGGTCATATGTCATTAGTGTGGACGCT
GCTGTCTTAAGTCTGTGGCCATGGCACCAGAACACAAAGCTTGTGCCTCTTACTCAGCTGTCCACGGAGCCTANGAAGCG
CCTGGGCCCAGGCACCAGCCTTGCTCTCAGAGAAGATGTGTCTGCAGGCAGCGTGGACCTGTGCTATCTTCCTAGAACAC
ATTGNACTCATGTTTTTAACACTTGGNTTTTGATTTTAAAAATTAGTATGAGTGCTTCAGATATGAAAACAG
Sequence Type mRNA
Unitrap ID UNI3108

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 83335450..83413724 186
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042700 (Sipa1l1) NM_172579 signal-induced proliferation-associated 1 like 1 Gene [Source:MGI Symbol;Acc:MGI:2443679]

 
Come back to gene ENSMUSG00000042700


For any suggestions or comments, please send an email to unitrap@crg.es