Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST29980
Clone ID OST29980
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST29980
Sequence
GCACGCGTCTGCTCCAACCGCCCGGTCTGATCCGNAAATACGGGCTGAACATGTGCCGCCAGTGCTTNCGGCAGTACGCG
AAGGACATAGGCTTCATTAAGTNGGACTAAGCGACCTTGAATGGATTCGACTGACTACTACCAAGTGGAACCGATCATGC
TAGTCTTTGTACACNNAGAATAAAAATGTGAAGAACTTT
Sequence Type mRNA
Unitrap ID UNI14768

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 70258711..70259746 95
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034892 (Rps29) NM_009093 ribosomal protein S29 Gene [Source:MGI (curated);Acc:Rps29-001]

 
Come back to gene ENSMUSG00000034892


For any suggestions or comments, please send an email to unitrap@crg.es