Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST29850
Clone ID OST29850
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST29850
Sequence
GGACGGATCGATTCTCCTCCAATACCAGTGGAAGCTCAGGGCGCAAATTCAAGTGATTTCAAGAAAGAAGCCACAGACCT
AGAGCCCTACCTCGTGTCTGTGTTAAGCCATTGAGACAGGAGTTCCAAGAAGGCTTTGATGGATTGTGCACATAGGGAAG
ATCTTGCTAGAAACTTCCCTGGGCTTCCTCCCTTATTCTTGTGTGTGTGCGCGCGCACACACGCACGTGTGTTGATGGGG
AAGGGGTT
Sequence Type mRNA
Unitrap ID UNI28487

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 81734357..81734604 248
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031682 (1700011L22Rik) RIKEN cDNA 1700011L22 gene Gene [Source:MGI Symbol;Acc:MGI:1914937]

 
Come back to gene ENSMUSG00000031682


For any suggestions or comments, please send an email to unitrap@crg.es