Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST29841
Clone ID OST29841
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST29841
Sequence
GGGCATACTTTGAGAAGACACACGAGCAGCTGACACCCCTTGTCAGGTCAGCAGGAACTAGTCTGGTGAACTTCTTCAGC
AGTTTAATGAACCTCGAGGAGAAACCGGCTCCTGCGGCTAAGTGAGATGTGCCAGGCCCAGTCTTCCCACCCCAGCTGCT
CCACTGGCCACCGCTAGAGCCCCTCTCCCTACCTTCTGCCTGTTTTCTCCAATAAATGCGGAAGGAGTTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI28488

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 173156273..173156504 230
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005681 (Apoa2) NM_013474 apolipoprotein A-II Gene [Source:MGI (curated);Acc:Apoa2-002]

 
Come back to gene ENSMUSG00000005681


For any suggestions or comments, please send an email to unitrap@crg.es