Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST29654
Clone ID OST29654
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST29654
Sequence
GATATGGAGACACAGATGGTTTTAATCTGGAGGATGCACTGAAAGAAACTTCCTCAGTAAAGCAGAGATGGGACCANTTN
NGCACNACNACTAGGAGGCCNGNANCAACCANANCCNCANCATATCCNGCTNAGAGATGGGACCATGTTGCCNCTACTAC
NACTATGAAGGCCAGGAACAACTANAGCACCATCAAATCCTATGGAACTAGATGGGTTTGACTTGGAAGATGCCTTGGAT
GATCGAAATGATCTAGATGGTCCCAAAAAGCCAAGTGCAGGAGAAGCAGGAGGTTGGTCAGACAAGGATCTTGAAGACAT
CGTGGAAGGTGGGGGATACAAACCTGACAAGAATAAAGGCGTAT
Sequence Type mRNA
Unitrap ID UNI28496

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 68691308..68703848 90
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035776 (Cd99l2) NM_138309 CD99 antigen-like 2 Gene [Source:MGI (curated);Acc:Cd99l2-006]

 
Come back to gene ENSMUSG00000035776


For any suggestions or comments, please send an email to unitrap@crg.es