Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST29603
Clone ID OST29603
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST29603
Sequence
ACACTGCATATGCGAAGAACACGACTGAACGGGAAATGGTATTACTTTGATGATAGCAGTGTGTCCCTGGCCTCTGAGGA
CCAGATAGTGACGAAAGCCGCCTACGTGTTGTTCTATCAGCGTCGGGATGACGAATGCTCCAGCACATCTTCGCTCGGCA
GTTTCCCCGGTTCTGATGGAGGGGTGAAGCTGAGCAGCTCACACCAGGGCATGGGGGATGAGGAGGCTTACAACATGGAC
ACCAACTGATGTGGCCTCTGTGACCCTGCCACCCTCCCAACACCAGCATCCTCCCCCAGGAGAATATCTGTGGCCTTTTT
GAAGACTGCTCATATCAATCTCAAACCAGATGAGGACATTACCTCCTTT
Sequence Type mRNA
Unitrap ID UNI28381

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108293311..108294288 274
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032612 (Usp4) NM_011678 ubiquitin specific peptidase 4 (proto-oncogene) Gene [Source:MGI Symbol;Acc:MGI:98905]

 
Come back to gene ENSMUSG00000032612


For any suggestions or comments, please send an email to unitrap@crg.es