Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST29583
Clone ID OST29583
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST29583
Sequence
GTGTGGTGTCAGCGCAGCGACAGGTCACCGTCCAGGAAGGGCCCTTGTACCGCACAGAGAGCTCCCACATCACCATCTGG
TGCAACGTGAGTGGCTACCAGGGTCCCTCTGAGCAGAACTTCCAGTGGTCCATTTACCTGCCCTCTGCTCCTGAGCGTGA
AGTACAGATCGTTAGCACGGTGGACTCTTCCTTCCCGTACGCCATCTACACCCAGCGAGTCCGCGGTGGGAAGATCTACG
TGGAGAGGATCCAGGGCAACTCAGCCTTACTTCACATCACAGACCTGCAAGCCCGGGATGCCGGCGAGTATGAATGTCAC
AACCCCCAACACCGATGAGCGCTACTTTGGGAGTTACAGTGCCAAGATGAACCTAGTGGTGATCCCAGATTCTCT
Sequence Type mRNA
Unitrap ID UNI11370

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 101229374..101229751 375
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042035 (Igsf3) NM_207205 immunoglobulin superfamily, member 3 Gene [Source:MGI Symbol;Acc:MGI:1926158]

 
Come back to gene ENSMUSG00000042035


For any suggestions or comments, please send an email to unitrap@crg.es