Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST29514
Clone ID OST29514
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST29514
Sequence
GCACCCAGGGGCTCACTGAGAAATGAAGAGTCCACGTTCTTCCCTTGGTCACAGCTAAAAGGAGCCAATAAACCAAAAGT
GGACCAAT
Sequence Type mRNA
Unitrap ID UNI28499

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 25946615..25946702 88
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037437 (Adam32) NM_153397 a disintegrin and metallopeptidase domain 32 Gene [Source:MGI (curated);Acc:Adam32-001]

 
Come back to gene ENSMUSG00000037437


For any suggestions or comments, please send an email to unitrap@crg.es