Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XH694
Clone ID XH694
Vector pGT1Lxf
Project baygenomics

Sequence tag XH694
Sequence
GGTTCGAGATATGTGTTTTTTTGTCAATGAGCAGCCGTTCACCATGAAATGGATAGATGAGGAAGGAGACCCATGTACAG
TGTCTTCTCAGTTGGAGTTAGAAGAGGCTTTCAGGCTGTACGAGCTGAACAAGGATTCTGAACTCTTGATTCATGTATTT
CCATGTGTACCAGAGCGTCCTGGAATGCCTTGCCCAGGGGAAGACAGAGACCCATGTACAGTGTCTTCTCAGTTGGAGTT
AGAAGAGGCTTTCAGGCTGTACGAGCTGAACAAGGATTCTGAACTCTTGATTCAT
Sequence Type mRNA
Unitrap ID UNI9342

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 30917529..30925229 92
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037643 (Prkci) NP_032883 protein kinase C, iota Gene [Source:MGI Symbol;Acc:MGI:99260]

 
Come back to gene ENSMUSG00000037643


For any suggestions or comments, please send an email to unitrap@crg.es