Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST29360
Clone ID OST29360
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST29360
Sequence
GGACACCAAAAGCACCACAGGAAGTCGCAAAGACCCTCCAGAGCCTGCCAGCAATTTCTCAAACGATGTCACCTGGCAAG
CTTTGCGCTGCCCTTATAGTACTGAGACTCTGCTCCTCTAGTTAGACTCTCTCAGTGGAAAGGAGGTGACCAGCCCTAGC
ACGGTTCTTATTCTCCCCACCCCCATCCTCACCAAGAGCACCCCAGTGCTCTCTGAAGGCACTGCCTCACAGTGTATCTA
TGACTGTGCCCCTAGTGCCGGCTGCACTTGCCACTCTTGTCTTATGCCTTCTGTTTACCCTACAAGAATGCAGGACACCT
CGGCCTCCTGTTGGCCTCACATTGCAATCAGAAAACTTGCAATGAAAATAATTAAATACATAGTGCATAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI28508

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 26185076..26185464 389
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060188 (Cxcl17) chemokine (C-X-C motif) ligand 17 Gene [Source:MGI Symbol;Acc:MGI:2387642]

 
Come back to gene ENSMUSG00000060188


For any suggestions or comments, please send an email to unitrap@crg.es