Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST29346
Clone ID OST29346
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST29346
Sequence
GGGATGCCCTGGACGCTCTGGGCCTAAAGCGCTACTGCTGCCGCCGCATGCTGCTAGCACACGTGGACCTGATTGAGAAG
CTGCTGAACTATGCACCCCTAGAGAAGTGACCGCTGGAGCCTGCCCTCCTCTGTCTCCTGCTGGCCACGGGCAGCCTGTC
GTGCTATGTTCAAACTGAGCTATTGNGGATGTTGGTGTATTGCCTGGCTG
Sequence Type mRNA
Unitrap ID UNI10358

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 148659095..148659304 208
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038489 (Polr2l) polymerase (RNA) II (DNA directed) polypeptide L Gene [Source:MGI (curated);Acc:Polr2l-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 126534990..126535199 208
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074846 (AL732330.14)  

 
Come back to gene ENSMUSG00000074846


For any suggestions or comments, please send an email to unitrap@crg.es