Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST29111
Clone ID OST29111
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST29111
Sequence
GTGCTGTGTAATGGACCAGGAACATGCGTCCCTATCTGTGTGTCCGCCCTGCTTCTTGGGATACTTGGAGTGAAGAAAGT
GATCATCGTCTATGTCGAGAGCATCTGCCGAGTGGAGACGCTATCCCTGTCAGGGAAGATCCTGAGGCACCTCTCCGACT
ACTTCATTGTTCAGTGGCCCACTCTCAAGGAGAAGTACCCCAAGTCTGTGTACCTGGGGCGAATTGTTTGACAAATGGCA
ACCCTAAGTCTTGAGAACATTACAAGTACCGATAATATTTACTATATACTATCTTTACTATAAAGTTTTTCAAAGGTCAA
GGAAATATCAATGGTAAAGAATTTAAAATGTACAAATAACTCAATGAAGAAAGACAAA
Sequence Type mRNA
Unitrap ID UNI13874

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 121064474..121064851 378
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039887 (AC105336.14) NM_024178 UDP-N-acetylglucosamine transferase subunit ALG14 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q9D081]

 
Come back to gene ENSMUSG00000039887


For any suggestions or comments, please send an email to unitrap@crg.es