Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST28964
Clone ID OST28964
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST28964
Sequence
ACTTAATGTACTCACAAGTACCACAACCCAAGAAACGACGTCTAATGTATGAGAAAGTCCCTGGAAGAGTGGATGGGCAA
ACCCGGCTGAAGTTTTTATGAAAAAAACAGAAGGGACAGTGCCACCTGCCAGATTCTATTTCCTTATGCCAATCCAGTAA
CCAAGTATTTAGGCTTGACTCCACATCAAAGAAAATGCCATTGTTTTTACATGTCCTCGGTGTTTATATCTAAGTCTGCT
TGTCTGACTTATCAATTAACATAATAAGCATAACCCCCCCCCCAAATAC
Sequence Type mRNA
Unitrap ID UNI28519

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 59056557..59056839 283
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038598 (AI481877) Likely orthologue of H. sapiens chromosome 9 open reading frame 84 [Source:UniProtKB/TrEMBL;Acc:A2ALV5]

 
Come back to gene ENSMUSG00000038598


For any suggestions or comments, please send an email to unitrap@crg.es