Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST28934
Clone ID OST28934
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST28934
Sequence
GACGAAACAGAAGAAATCTGTCACCAAGACTGTACAACANGCACCAAATCCAACCATAATTCCCAGCTCCCCGGTTATCC
AAGGAGACAACCCAGATGNACCGCAAAGCTCGCACCCCTCTGCAGGTCACACTCCAGGTCCCCAAACTCCAGTCAACTCT
CCCAACAACCCACCTCCGAGCCCGTGTAAGAGCACCAAGTAGGTCCTAGTCTAGCTGAGGTCCAGATCTATGCCATGCTG
GGGTGACATTTTAGAGACTGACCGAAATAGGTGAGACCCTGCCTGTATTCAGAAATGTGGAACAGAGAAATGGTGGGCCA
GGAGTGAAGGCAGATTTAGGGAAATAAACATTGTGTGTTAAATCTTTAAAA
Sequence Type mRNA
Unitrap ID UNI28523

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 173056715..173057081 361
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026649 (1700009P17Rik) NM_001081275 RIKEN cDNA 1700009P17 gene Gene [Source:MGI Symbol;Acc:MGI:1922722]

 
Come back to gene ENSMUSG00000026649


For any suggestions or comments, please send an email to unitrap@crg.es