Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST28888
Clone ID OST28888
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST28888
Sequence
AAGGTGTCTCCGTGCCTCTTCTTTGTGCCGGGCATCCTGCTGTTAGTCCCAGGAGTCTACCATGTGATCTTCATCTACTG
CGCTGTCAAGGGCCGCCGGGGCTTCCAATTCTTCTACCTGCCCTACTTTGAGAAGTGAGCTGCAACTGGCCAGTGGCTCA
CCAGTGATCCAAGGCCTCAGGTCACCTCCACGTGTCCACAGGGTATTCCTCCAACCTACACCTGGTTCTGTTCCTTTCAC
CTGGAAGGCAGAGGCCCCTGGGACCCTCACAACCACCAGGCCCCTTTGAATTTGCTCAGGAAGTTTAGAGCATGCCAGCC
TGGGAATATTGCCTCTTACCTGATGTGTGCCTTAACTTATTCCTGGGTTCTGGACTCCTGGGTTGGTGTAATTTTGTGCT
AATAAAAGGGTAATTATTTCCAACA
Sequence Type mRNA
Unitrap ID UNI28526

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4131227..4131731 372
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024845 (Tmem134) NP_001072117 transmembrane protein 134 Gene [Source:MGI Symbol;Acc:MGI:1914240]

 
Come back to gene ENSMUSG00000024845


For any suggestions or comments, please send an email to unitrap@crg.es