Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST28719
Clone ID OST28719
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST28719
Sequence
GTGCAGAATAAAGTCTTCCTGGCCCAGCGAGCTGTGGCTCTGAGCTCAAGGAATGGAACTTCCTGATAAGTCTGGCTGAA
CCTTCAGCCCCTCAGCTTCAGTGACTTCATATCAAGTGATGGGACTCTTTCATCTCTGGAACCAAATTCCCCGCCCTCTG
CCACCCGAATGCTACACTCTCAATTGAACCGTATTAATAAACAACAGTCAAGGCCAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI28533

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3617393..3617607 215
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019734 (Tmc4) NM_181820 transmembrane channel-like gene family 4 Gene [Source:MGI (curated);Acc:Tmc4-001]

 
Come back to gene ENSMUSG00000019734


For any suggestions or comments, please send an email to unitrap@crg.es