Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XE491
Clone ID XE491
Vector pGT1Lxf
Project baygenomics

Sequence tag XE491
Sequence
AAAGGCTTGATTTAAATTTGGATGAGATTATTCTTGCATCAAGATGTTAATAAGCCAAAATTT
Sequence Type mRNA
Unitrap ID UNI9369

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 107095806..107095866 61
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049606 (Zfp644) NM_026856 zinc finger protein 644 Gene [Source:MGI (curated);Acc:Zfp644-001]

 
Come back to gene ENSMUSG00000049606


For any suggestions or comments, please send an email to unitrap@crg.es