Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST28451
Clone ID OST28451
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST28451
Sequence
AGCCCAGCATGGGTTTCCTGACTGCCGTGACTCAAGGCCTGGTGCGGGGAGCTGACAGGATGAGCAAGTGGACAAGCAAG
CGGGGACCACGCACCTTCACTAAGAGTCGGGGTGCCAAGAAAACAGGCATCTATACTTCTGATAGGAAGTTTGTGCAAAT
AAAAGAAATGGTTCCAGAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI13909

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 24830008..24830186 179
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036850 (Mrpl41) NM_001031808 mitochondrial ribosomal protein L41 Gene [Source:MGI (curated);Acc:Mrpl41-001]

 
Come back to gene ENSMUSG00000036850


For any suggestions or comments, please send an email to unitrap@crg.es