Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST28440
Clone ID OST28440
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST28440
Sequence
ACTGAGATGCATCACAAAGGCCCTATTCAACGCCCAGTTCGGGAGCATCTTCCGCACCTTCCACAACCCTACCTACTTCT
CCCGGCGCCTCGTGCGCTTCTCCGACCTCTACATGGCCTCACTCAGCTGCCTGCTCAACTACCGCGTAGACTTCACCTTC
TACCCGCGCCGCACACCCCTGCAGCACGAGGCACCCCTCTGGATGGACCAGCTGTGCACTGGCTGCATGAAGACACCCTT
TCTTGGTGACATGGCCCACATCCGCTGAGGGCACTTTTATTGTCCTGGACAGACCATTGGCCCCCTCAGCCACCCTGACA
AGCAATAAAAATGGTCTGTGTCTTCTCAGAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI28540

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 31951965..31952310 346
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071547 (Nt5dc2) NM_027289 5'-nucleotidase domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1917271]

 
Come back to gene ENSMUSG00000071547


For any suggestions or comments, please send an email to unitrap@crg.es