Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XH003
Clone ID XH003
Vector pGT1Lxf
Project baygenomics

Sequence tag XH003
Sequence
ACCAGGAAGACAGCTCGGACAAAGCCCAGAAGCGGAAAATAGAAGAGAGTGATGAAGAAGCTGTACAAGCCAAAGTCTTA
CGGCCCCTGAGGAGCTGCGAGGAGCCTCTCACACGCACCGCCTCACTCACCTACTGCCATGGAGCAGATCATCCACGACC
CGGTTTCTCGCCGG
Sequence Type mRNA
Unitrap ID UNI9375

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4324903..4326837 132
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054611 (Fbxl11) NM_001001984 F-box and leucine-rich repeat protein 11 Gene [Source:MGI Symbol;Acc:MGI:1354736]

 
Come back to gene ENSMUSG00000054611


For any suggestions or comments, please send an email to unitrap@crg.es