Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST28198
Clone ID OST28198
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST28198
Sequence
TACTGTCTCTTCCTGAAAGAGGAGGAGACACGCTCTTTGCCTCTCATCATTGGCAGCACGCATCGGAGGCCTCCTGGTCT
TGGTTGTGATTATAGCCATTTTGTTCAAGTGTGGCTTTTTCAAAAGAAAATATCAACAACTGAACTTGGAGAGCACAAGG
AGGGCCCAGCTGAAGGCTGACAGTCTGCTCCAAGATTAGCCCCCTGCTTCCTCACCGGAAGGAGGGAGTTTGAGCCAGTC
GGAAGCCGGGATGCCCCCTATCGGGGCCCCTTACTCTCCTTAGGACGATCAAGCAACATCAAAGAACTGTAGAGTGTTGN
TCATAGCCACACACTATGCCCACAGTGTCTTGTGAATTGAGCAATAGGGAAACTTAAGGATGTGGGCTTTTAAAATACAT
TTACTTTTACANGCAGGGCCTTTAATGNGNACGGTTTCCCAAGCTTTGCCATGC
Sequence Type mRNA
Unitrap ID UNI21324

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 72959046..72960891 313
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005947 (Itgae) NM_008399 integrin alpha E, epithelial-associated Gene [Source:MGI (curated);Acc:Itgae-001]

 
Come back to gene ENSMUSG00000005947


For any suggestions or comments, please send an email to unitrap@crg.es