Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST28126
Clone ID OST28126
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST28126
Sequence
GGCTCCTCCTACTGCTAGAATCGGCTCTTCACCCAAAGCGTCACTGCTACACGTTTTCAGAGGACATTGAGTCCCCACCC
CTCTTTCTTGACCGGAACCAGCTCCTACAGTGGTCCATCAAGGCCCCTGTCTAGTTTGCAAGAAGTTATGCTTTGCTGAG
TTTTGTCTACCTCCTGAAGTAGAGTTGTAAGACCCCACTCCCCCCAGCCTCCGGGCCCAGACTCTGAAATAAAGATACAA
ACAACAAGGCCT
Sequence Type mRNA
Unitrap ID UNI14077

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 112066287..112066538 252
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031727 (Pmfbp1) NM_019938 polyamine modulated factor 1 binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1930136]

 
Come back to gene ENSMUSG00000031727


For any suggestions or comments, please send an email to unitrap@crg.es