Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XH155
Clone ID XH155
Vector pGT1Lxf
Project baygenomics

Sequence tag XH155
Sequence
TCATGATCCCCAAGACTTCGCAGAGAAGCTTCTGAAGCAGCTGGAGAGCTGTAAGGAGCGGTTTGAGGTGAAGATGATGC
TCATGAACCTCATCTCCAGATTGGTGGGCATTCACGAGCTTTTCCTCTTCAACTTCTACCCTTTTGTGCAAAGGTTTCTG
CAGCCCCACCAGAG
Sequence Type mRNA
Unitrap ID UNI9385

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 92725039..92726251 106
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029415 (Sdad1) NM_172713 SDA1 domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2140779]

 
Come back to gene ENSMUSG00000029415


For any suggestions or comments, please send an email to unitrap@crg.es