Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XH157
Clone ID XH157
Vector pGT1Lxf
Project baygenomics

Sequence tag XH157
Sequence
AGCGGAAGCAGGCCGAGTCAGAGAGGCCCATCCTGCCAGCCAACCAGAAGCTGATCACTCTATCTGTACAAGATGCACCC
ACAAAGAAAGAGTTTGTCATCAATCCCAATGGGAAGTCTGAGGTTTGCATCCTGCACGAATACATGCAGCGTGTCCTCAA
GGTCCGCCCTGTTTATAATTTCTTTGAATGTGAGAATCCAAGTGAGCCTTTTGGTGCCTCCGTGACCATTGATGGTGTGA
CTTACGGATCTGGAACTGCAAGCAGCAAAAAACTTGCGAAGAATAAAGCT
Sequence Type mRNA
Unitrap ID UNI9380

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 18277260..18278501 104
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022718 (Dgcr8) NM_033324 DiGeorge syndrome critical region gene 8 Gene [Source:MGI (curated);Acc:Dgcr8-002]

 
Come back to gene ENSMUSG00000022718


For any suggestions or comments, please send an email to unitrap@crg.es