Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST28029
Clone ID OST28029
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST28029
Sequence
GGCGGTGGCAGTACTGCAGGTGCATCGAGAAATGGAGTCAACATGATACGGAACTGAACTCTGTGGGTTCCTGGGGATGG
AAGGACCGACAGAGCGGCTGAGCTGCTGGCTCTCTGGAGACTCCGTAGAGAACCCAGCGATCAAAAAACCCACTGTGATG
TGTTGGTGGCTTTGTCTGAAGCACCAGGGAGTTTGGTGAAGCTAAAGGAGTCATAGGAGACTTGCAGTGGCTGGATGTTC
TCACGCCTGGCTCCGTTCTGCCTGTCTGGAGGCCTGGTCTGCTGGTCCACCTTCTTGACTGAAGATTGGGTGTTTTCCAT
ATTCTGGGAACATTTTTTTCCCTCCACTCCCCCTNCCNCCACCCCCACTNAAAATGGAATCTTCACTCCCTTGACTACTT
GATTACTGCATTNNTGCTCTTGGTCTAGCTGTGTGAACTCTACTTCTTTC
Sequence Type mRNA
Unitrap ID UNI28556

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 163875721..163876169 422
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054582 (1810053B01Rik) NP_001107551 RIKEN cDNA 1810053B01 gene Gene [Source:MGI Symbol;Acc:MGI:1922908]

 
Come back to gene ENSMUSG00000054582


For any suggestions or comments, please send an email to unitrap@crg.es