Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST27888
Clone ID OST27888
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST27888
Sequence
TGCTAGAGATCTGTTACACCCTTCCTTGGAGGAGGAGAAGAAAAAACATAAGAAGAAACGGCTGGTTCAGAGCCCAAATT
CTTACTTCATGGATGTGAAATGTCCAGGTTGCTACAAGATTACTACAGTTTTCAGCCATGCACAGACTGTGGTTCTTTGT
GTGGGTTGTTCAACTGTGTTGTGCCAGCCCACAGGAGGAAAAGCCAGGCTCACAGAAGGCTGTTCATTTAGAAGAAAGCA
ACACTAATGAGCTATGAAGTTCCGGAATTTGTGTTTTTCACAGAAAGCCTTACCAACTTCAGTTACTTTACCAAGACAAT
GTAATTATTGTTTGATTTTATAAAGTCTACAACAATGATCTCCTATTTTGGTGNCAGTTTTTCAATAAAGTTTTAATTAT
GGACAA
Sequence Type mRNA
Unitrap ID UNI13939

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 66794641..66797323 188
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036781 (Rps27l) NM_026467 ribosomal protein S27-like Gene [Source:MGI Symbol;Acc:MGI:1915191]

 
Come back to gene ENSMUSG00000036781


For any suggestions or comments, please send an email to unitrap@crg.es