Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST27682
Clone ID OST27682
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST27682
Sequence
GGGGAGAGTACCAACAATCTCCATTAATAAGACAGAAGGATGCCACCTGTACCTCAGTGAAGATGCACTAGACTGTGAGA
TCGTGAGCGCGAAGTCGTCCGAGATGAATGTCCTGGTCCCTCAGGATGACGATTATAGAGAATTCCCCATTCCCGAGCAG
TTCAAGACAATATGGGATGGCTCCAAGCTGGTCACCGAACCTGCAGAGATCATGGCCTGACATCCAAGAAATAGCCTTCC
CTGAGTCTCCTCTAGCGAACAGAAGCAAGCAGCTAATAGGAGCTAGATTTTACCATAGCCCCGACGCCCGTGTCCGTGTC
CGAATCCTGCAGTTCTG
Sequence Type mRNA
Unitrap ID UNI13036

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 46741900..46743850 201
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021373 (Cap2) NM_026056 CAP, adenylate cyclase-associated protein, 2 (yeast) Gene [Source:MGI (curated);Acc:Cap2-001]

 
Come back to gene ENSMUSG00000021373


For any suggestions or comments, please send an email to unitrap@crg.es